Inventory
All the information you need, accessible and connected
- A unified database
- All the information you need, accessible and connected
- All the information you need, accessible and connected
Laboratory operations, connected
The all-in-one platform for primer management
Centralize primer inventory, validation and traceability across your laboratory.
PrimerHub
PrimersSamplesValidationsTo Design
GJB2
GRCh37NM_004004.6Exon 2Amplicon
PCR ForwardPCR Reverse
TGGCCTCATGTCAAATATTTGAGTGTAATTTGTTAGAAGCAATACAGCTGGATGTACCACCAACATCTACCTGTAATGACAGCCTGTCCAACACATCTCCCTTTTCCATGACTGTGGTAGCCAGTGGCCCAGTTACAGAAAAGCTTCT
Comments
Add notes or context about this primer design
Activity
Primer design added and ready to validate
The platform
Explore PrimerHub
One connected workspace for every primer, sample and validation. PrimerHub replaces fragmented spreadsheets and folders with a reliable source of truth.
Find what you need quickly, understand its history and move work forward with confidence.
PrimerHubInventory
Discovery
Efficiency
Traceability
Quality
Discovery
All the information you need, accessible and connected
- A unified database
- All the information you need, accessible and connected
- All the information you need, accessible and connected
Efficiency
All the information you need, accessible and connected
- A unified database
- All the information you need, accessible and connected
- All the information you need, accessible and connected
Traceability
All the information you need, accessible and connected
- A unified database
- All the information you need, accessible and connected
- All the information you need, accessible and connected
Quality
All the information you need, accessible and connected
- A unified database
- All the information you need, accessible and connected
- All the information you need, accessible and connected
Impact
Efficiency that shows up on the balance sheet
Stop stitching together files and folders. PrimerHub turns a fragmented workflow into a single interconnected source of truth.
Save time
Quickly access and manage all the information you need.
Reduce errors
Rely on accurate, centralized data to make confident decisions.
Increase productivity
Simplify workflows and help the whole laboratory operate efficiently.
Pricing
Plans that scale with your lab
Simple per-seat pricing. Add or remove seats as your team changes.
1–5 seats
Small Lab
For small teams replacing spreadsheets with one shared primer library.
- Complete platform access
- Standard data onboarding
- Email support
Billed per active seat
Request a demo6–20 seats
Growing Lab
For laboratories coordinating primer work across a growing team.
- Complete platform access
- Guided data import
- Priority support
Billed per active seat
Request a demo21+ seats
Enterprise
For multi-team organizations that need rollout and support at scale.
- Complete platform access
- Tailored onboarding
- Dedicated support
Billed per active seat
Contact usFAQ
Frequently asked questions
PrimerHub supports self-service imports through a standardized template. If you prefer, our team can perform a fully customized migration for your laboratory as an additional service.
Request a demo
See how PrimerHub works
Request a demo and receive a personal access link in your email.
- Full access to all features
- Explore preloaded demo data
- Personal demo workspace for 24 hours